Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0021001 | |||
Gene | ARFIP2 | Organism | Human |
Genome Locus | chr11:6499967-6501693:- | Build | hg19 |
Disease | Intracranial aneurysms | ICD-10 | Dissection of cerebral arteries, nonruptured (I67) |
DBLink | Link to database | PMID | 29291016 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | 223 cases of IA patients included 141 males and 82 females |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GAAACTCGAGCCGCGCTGCGATATGTG ReverseCACAGCCAGCAAAGTTACTCGCTTTAAA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Teng, L, Chen, Y, Chen, H, He, X, Wang, J, Peng, Y, Duan, H, Li, H, Lin, D, Shao, B (2017). Circular RNA hsa_circ_0021001 in peripheral blood: a potential novel biomarker in the screening of intracranial aneurysm. Oncotarget, 8, 63:107125-107133. |